u2os cells Search Results


95
CLS Cell Lines Service GmbH human osteosarcoma cell line u 2 os
Fig. 1. Activity of SSR against FGF2 and FGF8b. (A–D) Fluorescence intensity analysis <t>of</t> <t>U-2</t> OS cells immunolabeled for pMAPK (pY202/ 204) (A, B) or pPLCγ1 (pY783) (C, D) after stimulation with FGF2 (A, C) and FGF8b (B, D) and in the presence and absence of 25 μM SSR. The statistical significance was evaluated using the Mann–Whitney U test (*P < 0.05; **P < 0.01; ***P < 0.001; n.s., non-significant). Number of biologically independent replicates is n = 4 for A, B, and D; and 3 for panel C. (E) Representative microscopic images of proliferating bEnd.3 cells (EdU+, green; upper panel) and total bEnd.3 cells (nuclear marker DAPI, gray; bottom panel). Length of the scale bar equals 100 μM. (F) Percentage of proliferating human bEnd.3 cells upon stimulation by FGF2 and FGF8b in the presence and absence of either 50 nM or 100 μM SSR. BSA was used as a negative control. Error bars represent the SEM. Number of biologically independent replicates is n = 3.
Human Osteosarcoma Cell Line U 2 Os, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS+Cells/pm38997225-46-1-7
Average 95 stars, based on 1 article reviews
human osteosarcoma cell line u 2 os - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

92
CLS Cell Lines Service GmbH nup96 mmaple cells
a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex <t>protein</t> <t>Nup96-mMaple</t> acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).
Nup96 Mmaple Cells, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-CRISPR-NUP96-mMaple+Cells/pmc07611669-320-43-48
Average 92 stars, based on 1 article reviews
nup96 mmaple cells - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
CLS Cell Lines Service GmbH u 2 os crispr nup96 megfp cells
a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex <t>protein</t> <t>Nup96-mMaple</t> acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).
U 2 Os Crispr Nup96 Megfp Cells, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-CRISPR-NUP96-mEGFP+Cells/bio_rxiv__2021__12__23__473862-207-0-4
Average 94 stars, based on 1 article reviews
u 2 os crispr nup96 megfp cells - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Santa Cruz Biotechnology u 2 os
a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex <t>protein</t> <t>Nup96-mMaple</t> acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).
U 2 Os, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U-2+OS+Cell+Lysate/pm31180533-123-9-32
Average 91 stars, based on 1 article reviews
u 2 os - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

94
CLS Cell Lines Service GmbH crispr engineered nup96 snap u2os cell lines48
Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured <t>U2OS.</t> (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from <t>U2OS/Nup96-SNAP.</t> Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).
Crispr Engineered Nup96 Snap U2os Cell Lines48, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-CRISPR-NUP96-SNAP+Cells/pm36786384-299-0-8
Average 94 stars, based on 1 article reviews
crispr engineered nup96 snap u2os cell lines48 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
CLS Cell Lines Service GmbH u2os zfn snap nup107
Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured <t>U2OS.</t> (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from <t>U2OS/Nup96-SNAP.</t> Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).
U2os Zfn Snap Nup107, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-ZFN-SNAP-Nup107+Cells/pmc09417988__41557_2022_995_MOESM2_ESM-35-51-52
Average 91 stars, based on 1 article reviews
u2os zfn snap nup107 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
CLS Cell Lines Service GmbH human bone osteosarcoma epithelial cell line u 2 os crispr nup96 halo
Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured <t>U2OS.</t> (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from <t>U2OS/Nup96-SNAP.</t> Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).
Human Bone Osteosarcoma Epithelial Cell Line U 2 Os Crispr Nup96 Halo, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-CRISPR-NUP96-Halo+Cells/pmc09297387__SC___013___D2SC02448A___s001-164-3-14
Average 93 stars, based on 1 article reviews
human bone osteosarcoma epithelial cell line u 2 os crispr nup96 halo - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Elabscience Biotechnology u2os
Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in <t>U2OS,</t> 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA
U2os, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U-2+OS+%5BU2OS%5D+Cell+Complete+Medium/pmc12381239-253-4-34
Average 93 stars, based on 1 article reviews
u2os - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
CLS Cell Lines Service GmbH u2os crispr
Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in <t>U2OS,</t> 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA
U2os Crispr, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/U2OS-CRISPR-TPR-SNAP+Cells/pm40108461-462-7-14
Average 94 stars, based on 1 article reviews
u2os crispr - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Genecopoeia u 2 os cells
Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in <t>U2OS,</t> 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA
U 2 Os Cells, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/Human+cell+line+U-2+OS+stably+expressing+CRISPR+Cas9%2C+randomly+inserted%2C+single+clone/pmc06432714-157-0-7
Average 94 stars, based on 1 article reviews
u 2 os cells - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
Broad Institute Inc u2os cells stably expressing the gfp-fused zinc finger proteins
Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in <t>U2OS,</t> 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA
U2os Cells Stably Expressing The Gfp Fused Zinc Finger Proteins, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/u2os+cells/pmc12136240-216-1-17
Average 90 stars, based on 1 article reviews
u2os cells stably expressing the gfp-fused zinc finger proteins - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare u2os cell line
Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in <t>U2OS,</t> 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA
U2os Cell Line, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+cells/u2os+cells/pm23865508-16-30-44
Average 90 stars, based on 1 article reviews
u2os cell line - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 1. Activity of SSR against FGF2 and FGF8b. (A–D) Fluorescence intensity analysis of U-2 OS cells immunolabeled for pMAPK (pY202/ 204) (A, B) or pPLCγ1 (pY783) (C, D) after stimulation with FGF2 (A, C) and FGF8b (B, D) and in the presence and absence of 25 μM SSR. The statistical significance was evaluated using the Mann–Whitney U test (*P < 0.05; **P < 0.01; ***P < 0.001; n.s., non-significant). Number of biologically independent replicates is n = 4 for A, B, and D; and 3 for panel C. (E) Representative microscopic images of proliferating bEnd.3 cells (EdU+, green; upper panel) and total bEnd.3 cells (nuclear marker DAPI, gray; bottom panel). Length of the scale bar equals 100 μM. (F) Percentage of proliferating human bEnd.3 cells upon stimulation by FGF2 and FGF8b in the presence and absence of either 50 nM or 100 μM SSR. BSA was used as a negative control. Error bars represent the SEM. Number of biologically independent replicates is n = 3.

Journal: FEBS letters

Article Title: Differential effects of the N-terminal helix of FGF8b on the activity of a small-molecule FGFR inhibitor in cell culture and for the extracellular domain of FGFR3c in solution.

doi: 10.1002/1873-3468.14976

Figure Lengend Snippet: Fig. 1. Activity of SSR against FGF2 and FGF8b. (A–D) Fluorescence intensity analysis of U-2 OS cells immunolabeled for pMAPK (pY202/ 204) (A, B) or pPLCγ1 (pY783) (C, D) after stimulation with FGF2 (A, C) and FGF8b (B, D) and in the presence and absence of 25 μM SSR. The statistical significance was evaluated using the Mann–Whitney U test (*P < 0.05; **P < 0.01; ***P < 0.001; n.s., non-significant). Number of biologically independent replicates is n = 4 for A, B, and D; and 3 for panel C. (E) Representative microscopic images of proliferating bEnd.3 cells (EdU+, green; upper panel) and total bEnd.3 cells (nuclear marker DAPI, gray; bottom panel). Length of the scale bar equals 100 μM. (F) Percentage of proliferating human bEnd.3 cells upon stimulation by FGF2 and FGF8b in the presence and absence of either 50 nM or 100 μM SSR. BSA was used as a negative control. Error bars represent the SEM. Number of biologically independent replicates is n = 3.

Article Snippet: The human osteosarcoma cell line U-2 OS (CLS Cell Lines Service GmbH, Eppelheim, Germany; cat. no. 300364) was grown in growth medium consisting of high glucose DMEM/F-12 (Gibco, Grand Island, NY, USA; cat. no. 21041025) and supplemented with 1% GlutaMAX (Gibco; cat. no. 35050061), 1 unit mL 1 penicillin, 1 μg mL 1 streptomycin (Gibco; cat. no. 10378016), and 10% FBS (Satorius, Goettingen, Germany) at 37 °C and 5% CO2.

Techniques: Activity Assay, Fluorescence, Immunolabeling, MANN-WHITNEY, Marker, Negative Control

a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex protein Nup96-mMaple acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).

Journal: Nature methods

Article Title: Deep learning enables fast and dense single-molecule localization with high accuracy

doi: 10.1038/s41592-021-01236-x

Figure Lengend Snippet: a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex protein Nup96-mMaple acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).

Article Snippet: The pulse length of the 405nm laser was adjusted manually to maintain a high emitter density and to allow imaging of all fluorophores in the field of view in about 1 min. For the acquisition of live-cell data of Nup96-mMaple , coverslips containing Nup96-mMaple cells (catalog no. 300461; CLS Cell Line Service, Eppelheim, Germany) were rinsed twice with warm PBS before they were mounted in 1mL growth medium containing 20 mM HEPES buffer and imaged directly.

Techniques: Labeling, Activation Assay, Comparison, Concentration Assay, Immunolabeling

Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured U2OS. (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from U2OS/Nup96-SNAP. Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured U2OS. (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from U2OS/Nup96-SNAP. Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Membrane, Cell Culture, Imaging, Isolation, Labeling

Fig. 2 Structure of the NPC basket. (A) Correlative fluorescence/AFM image of an open nucleus isolated from U2OS overexpressing POM121-GFP. Left: TIRF image of the entire nucleus overlaid with the region scanned by AFM. Right: Height image acquired by AFM, encompassing the opening border. Scale bars are 5 µm (left), 2 µm (right). (B) Correlative TIRF/AFM image of the inner nuclear envelope of an open nucleus. NPCs are labelled with mAb414 and visualized as fluorescent dots that coincide with ring-like structures in the AFM image. Scale bars are 2 µm and 200 nm. (C) Representative samples of human nuclear pores (nucleoplasmic face) imaged by AFM. Scale bar is 100 nm. (D) Three configurations of NPC nucleo- plasmic region and their respective height profile. “Empty” (blue), protruding (orange) and low basket (green). (E) Mean of rotationally averaged NPC height profiles (n = 210). The shaded area represents the standard deviation. (F) (Left) Average image of 210 NPC crops. AFM color scale as above. (Right) Height profile of the resulting image. (G and H) Diameter and depths distributions of 210 NPCs plotted as frequencies and fitted with one (respectively two) Gaussians. The dashed line represents the fit function. These graphs are also shown in Fig. S2D & E† to illustrate the analysis workflow.

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 2 Structure of the NPC basket. (A) Correlative fluorescence/AFM image of an open nucleus isolated from U2OS overexpressing POM121-GFP. Left: TIRF image of the entire nucleus overlaid with the region scanned by AFM. Right: Height image acquired by AFM, encompassing the opening border. Scale bars are 5 µm (left), 2 µm (right). (B) Correlative TIRF/AFM image of the inner nuclear envelope of an open nucleus. NPCs are labelled with mAb414 and visualized as fluorescent dots that coincide with ring-like structures in the AFM image. Scale bars are 2 µm and 200 nm. (C) Representative samples of human nuclear pores (nucleoplasmic face) imaged by AFM. Scale bar is 100 nm. (D) Three configurations of NPC nucleo- plasmic region and their respective height profile. “Empty” (blue), protruding (orange) and low basket (green). (E) Mean of rotationally averaged NPC height profiles (n = 210). The shaded area represents the standard deviation. (F) (Left) Average image of 210 NPC crops. AFM color scale as above. (Right) Height profile of the resulting image. (G and H) Diameter and depths distributions of 210 NPCs plotted as frequencies and fitted with one (respectively two) Gaussians. The dashed line represents the fit function. These graphs are also shown in Fig. S2D & E† to illustrate the analysis workflow.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Isolation, Standard Deviation

Fig. 3 Tpr organization within the NPC basket. (A) Correlative AFM/dSTORM image of an open nucleus prepared from U2OS cells. The sample was immuno-labelled against Tpr. dSTORM imaging was performed in TIRF illumination. The same area was then imaged by AFM. After reconstruction of the dSTORM localizations map, the two images were correlated (scale bar is 200 nm). AFM color scale 0–300 nm. (B) 3D representation of the cor- related AFM/dSTORM image. (C) Three NPCs of typically different topographies are shown in more details, together with their rotationally averaged height profiles (upper panel). Arrows point at Tpr localizations (scale bar is 100 nm). AFM color scale 0–300 nm. (D) U2OS cells were fixed and simul- taneously immuno-labelled against Nup153, Tpr or Elys, with a secondary antibody coupled to STAR-635P (green) and Nup153 coupled to AlexaFluor 594 (red). Samples were imaged by STED microscopy. Individual NPCs are zoomed on the right (scale bars are 1 µm and 100 nm). (E) Distance distribution between the AlexaFluor 594 and STAR-635P signals measured from STED images (number of pores >2700).

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 3 Tpr organization within the NPC basket. (A) Correlative AFM/dSTORM image of an open nucleus prepared from U2OS cells. The sample was immuno-labelled against Tpr. dSTORM imaging was performed in TIRF illumination. The same area was then imaged by AFM. After reconstruction of the dSTORM localizations map, the two images were correlated (scale bar is 200 nm). AFM color scale 0–300 nm. (B) 3D representation of the cor- related AFM/dSTORM image. (C) Three NPCs of typically different topographies are shown in more details, together with their rotationally averaged height profiles (upper panel). Arrows point at Tpr localizations (scale bar is 100 nm). AFM color scale 0–300 nm. (D) U2OS cells were fixed and simul- taneously immuno-labelled against Nup153, Tpr or Elys, with a secondary antibody coupled to STAR-635P (green) and Nup153 coupled to AlexaFluor 594 (red). Samples were imaged by STED microscopy. Individual NPCs are zoomed on the right (scale bars are 1 µm and 100 nm). (E) Distance distribution between the AlexaFluor 594 and STAR-635P signals measured from STED images (number of pores >2700).

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Imaging, Microscopy

Fig. 4 Basket contribution in the topography of human NPCs. (A) Stable U2OS cells expressing Nup96-GFP were transfected with siRNAs, scrambled or targeted against Nup153. Cells were then fixed, co-labeled with anti-Nup153 (red) and anti-Tpr (blue) and imaged by confocal microscopy. Arrows indicate pores depleted of Nup153. They are consistently co-depleted of Tpr (scale bar is 1 µm). (B) Correlative AFM-fluor- escence image of a NE prepared from U2OS/Nup96-GFP cells depleted of Nup153 by siRNA and labeled with anti-Nup153. Panel d shows the ROI scanned by AFM. Top panels show the corresponding Nup96 (b) and Nup153 (c) channels imaged by TIRF. In panels b–d, NPCs are circled in white when Nup153 is detected and in red when it is absent or weak. Scale bars are respectively 500 nm (a–c) and 200 nm (d). (C) Rotationally averaged height profiles were averaged from over 80 pores imaged from control (black) and siNup153-treated cells (red). Shaded areas are standard devi- ations. (D) The average contribution of the basket in the NPC structure can be envisioned as the volume located between the average surface of control NPCs and of basket-depleted NPCs. A cross-section of this volume is represented as the grey shaded area.

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 4 Basket contribution in the topography of human NPCs. (A) Stable U2OS cells expressing Nup96-GFP were transfected with siRNAs, scrambled or targeted against Nup153. Cells were then fixed, co-labeled with anti-Nup153 (red) and anti-Tpr (blue) and imaged by confocal microscopy. Arrows indicate pores depleted of Nup153. They are consistently co-depleted of Tpr (scale bar is 1 µm). (B) Correlative AFM-fluor- escence image of a NE prepared from U2OS/Nup96-GFP cells depleted of Nup153 by siRNA and labeled with anti-Nup153. Panel d shows the ROI scanned by AFM. Top panels show the corresponding Nup96 (b) and Nup153 (c) channels imaged by TIRF. In panels b–d, NPCs are circled in white when Nup153 is detected and in red when it is absent or weak. Scale bars are respectively 500 nm (a–c) and 200 nm (d). (C) Rotationally averaged height profiles were averaged from over 80 pores imaged from control (black) and siNup153-treated cells (red). Shaded areas are standard devi- ations. (D) The average contribution of the basket in the NPC structure can be envisioned as the volume located between the average surface of control NPCs and of basket-depleted NPCs. A cross-section of this volume is represented as the grey shaded area.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Expressing, Transfection, Labeling, Confocal Microscopy, Control

Fig. 5 Mechanical properties of the NPC basket. (A) AFM height and stiffness images of NPCs. Scale bar is 100 nm. (B) Height and stiffness profiles measured from single pores (along the line depicted on the left panels). The light grey bars indicate the location of the scaffold’s ring. (C) Mean of rotationally averaged height (blue) and stiffness (red, dashed) profiles obtained from over 80 individual NPCs. (D) Mean of rotationally averaged stiffnesses of NPCs from nuclear envelopes pre- pared from control (blue profile) or Nup153-depleted (red) U2OS cells. Standard deviations are represented as shaded areas.

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 5 Mechanical properties of the NPC basket. (A) AFM height and stiffness images of NPCs. Scale bar is 100 nm. (B) Height and stiffness profiles measured from single pores (along the line depicted on the left panels). The light grey bars indicate the location of the scaffold’s ring. (C) Mean of rotationally averaged height (blue) and stiffness (red, dashed) profiles obtained from over 80 individual NPCs. (D) Mean of rotationally averaged stiffnesses of NPCs from nuclear envelopes pre- pared from control (blue profile) or Nup153-depleted (red) U2OS cells. Standard deviations are represented as shaded areas.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Control

Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in U2OS, 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA

Journal: Bone Research

Article Title: Chemotherapeutic drug-triggered AEP-cleaved G3BP1 orchestrates stress granules/nucleoli/mitochondria in osteosarcoma

doi: 10.1038/s41413-025-00453-w

Figure Lengend Snippet: Chemotherapeutic drugs induced SG assembly and triggered AEP to specifically cleave G3BP1 at N258/N309. a Representative immunofluorescences (IF) images of SG assembly in U2OS, 143B, U87-MG and A549 cells exposed to cisplatin (5 and 50 μmol/L) or vehicle for 6 h. Scale Bar = 10 μm. b Quantification of the counts of SGs per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c WB analysis of G3BP1 and AEP in U2OS and 143B with NC or AEP-knockdown (KD) exposed to different chemotherapeutic drugs for 6 h. The arrows point out the truncated fragments of G3BP1 cleaved by AEP. d In vitro cleavage experiment of AEP and G3BP1 (WT and point mutants) purified recombinant proteins. Data are expressed as mean ± SD. *** P < 0.001, **** P < 0. 0001. Comparisons were conducted using one-way ANOVA

Article Snippet: Stable cell lines of U2OS, 143B, and U87-MG were seeded in 96-well cell culture plates and treated with cisplatin (50 μmol/L) or appropriate vehicle solution for 6 h. OCR Fluorometric Assay Kit (Cat# E-BC-F068, Elabscience, Wuhan, China) was used according to manufacturer’s protocol.

Techniques: Knockdown, In Vitro, Purification, Recombinant

tG3BP1-Ns competitively bind to full-length G3BP1 and negatively modulate SG. a Representative images of SGs in U2OS cells with or without AEP-KD exposed to cisplatin (50 μmol/L), doxorubicin (50 μmol/L) for 6 h. Scale bar = 10 μm. b Quantification of the SG counts per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c Representative images of G3BP1-FL colocalized with tG3BP1-Ns or tG3BP1-Cs in Hela cells. Scale bar = 5 μm. d Co-IP and WB assays of mCherry-tagged tG3BP1-Ns or Cs cotransfected with flag-tagged full-length G3BP1 in HEK293T. e Representative images of SGs in tG3BP1-Ns overexpressed U2OS cells exposed to cisplatin (5 μmol/L), doxorubicin (5 μmol/L) for 6 h. Scale bar = 10 μm. f Quantification of SG counts per cell ( n = 50) and SG + cell ratio ( n = 6) of ( e ). Data are expressed as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.000 1. ns no significance. One-way ANOVA

Journal: Bone Research

Article Title: Chemotherapeutic drug-triggered AEP-cleaved G3BP1 orchestrates stress granules/nucleoli/mitochondria in osteosarcoma

doi: 10.1038/s41413-025-00453-w

Figure Lengend Snippet: tG3BP1-Ns competitively bind to full-length G3BP1 and negatively modulate SG. a Representative images of SGs in U2OS cells with or without AEP-KD exposed to cisplatin (50 μmol/L), doxorubicin (50 μmol/L) for 6 h. Scale bar = 10 μm. b Quantification of the SG counts per cell ( n = 50) and SG + cell ratio ( n = 6) in cells of ( a ). c Representative images of G3BP1-FL colocalized with tG3BP1-Ns or tG3BP1-Cs in Hela cells. Scale bar = 5 μm. d Co-IP and WB assays of mCherry-tagged tG3BP1-Ns or Cs cotransfected with flag-tagged full-length G3BP1 in HEK293T. e Representative images of SGs in tG3BP1-Ns overexpressed U2OS cells exposed to cisplatin (5 μmol/L), doxorubicin (5 μmol/L) for 6 h. Scale bar = 10 μm. f Quantification of SG counts per cell ( n = 50) and SG + cell ratio ( n = 6) of ( e ). Data are expressed as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.000 1. ns no significance. One-way ANOVA

Article Snippet: Stable cell lines of U2OS, 143B, and U87-MG were seeded in 96-well cell culture plates and treated with cisplatin (50 μmol/L) or appropriate vehicle solution for 6 h. OCR Fluorometric Assay Kit (Cat# E-BC-F068, Elabscience, Wuhan, China) was used according to manufacturer’s protocol.

Techniques: Co-Immunoprecipitation Assay

tG3BP1-Cs translocate into the nucleolus and sequester mRNAs of ribosomal proteins in the nucleolus to inhibit cellular translation. a Representative images of the sub-nucleolar localization of tG3BP1-Cs and sub-nucleolar markers in Hela cells. Scale bar = 5 μm. b Representative images of FISH and IF assays present the nucleolar colocalization of tG3BP1-Cs with FAM-conjugated probes of ribosomal mRNAs, RPS4X, RPL11, and RP27A. c SUnSET experiments analyzed the protein synthesis in U2OS, 143B, and U87-MG cells treated with cisplatin (50 μmol/L) or vehicle for 6 h. d Quantification of protein synthesis of the aforementioned cell lines exposed to cisplatin (50 μmol/L) or vehicle for 6 h were detected with the Click-iT HPG system ( n = 3). Data are expressed as mean ± SD. ** P < 0.01, **** P < 0.000 1. ns no significance. One-way ANOVA

Journal: Bone Research

Article Title: Chemotherapeutic drug-triggered AEP-cleaved G3BP1 orchestrates stress granules/nucleoli/mitochondria in osteosarcoma

doi: 10.1038/s41413-025-00453-w

Figure Lengend Snippet: tG3BP1-Cs translocate into the nucleolus and sequester mRNAs of ribosomal proteins in the nucleolus to inhibit cellular translation. a Representative images of the sub-nucleolar localization of tG3BP1-Cs and sub-nucleolar markers in Hela cells. Scale bar = 5 μm. b Representative images of FISH and IF assays present the nucleolar colocalization of tG3BP1-Cs with FAM-conjugated probes of ribosomal mRNAs, RPS4X, RPL11, and RP27A. c SUnSET experiments analyzed the protein synthesis in U2OS, 143B, and U87-MG cells treated with cisplatin (50 μmol/L) or vehicle for 6 h. d Quantification of protein synthesis of the aforementioned cell lines exposed to cisplatin (50 μmol/L) or vehicle for 6 h were detected with the Click-iT HPG system ( n = 3). Data are expressed as mean ± SD. ** P < 0.01, **** P < 0.000 1. ns no significance. One-way ANOVA

Article Snippet: Stable cell lines of U2OS, 143B, and U87-MG were seeded in 96-well cell culture plates and treated with cisplatin (50 μmol/L) or appropriate vehicle solution for 6 h. OCR Fluorometric Assay Kit (Cat# E-BC-F068, Elabscience, Wuhan, China) was used according to manufacturer’s protocol.

Techniques:

tG3BP1-Cs bind to mitochondrial mRNA targets and suppress their translation to alleviate mitochondrial stress. a Representative images of the colocalization of tG3BP1-Cs with the mitochondrial marker TOMM20 in Hela cells. Scale bar = 10 μm. b RNP-IP analysis of the mRNA target encoding ribosomal proteins and oxidative phosphorylation binding to tG3BP1-Cs ( n = 3) in tG3BP1-Cs overexpressed U2OS cells. c Ribosome profiling-qPCR analysis demonstrated that tG3BP1 overexpression in U2OS cells significantly downregulates mitochondrial genes translation. d WB analysis of mitochondrial genes expression in cell lines exposed to cisplatin (50 μmol/L) or vehicle for 6 h. e Cisplatin-induced mitochondrial damage was detected by JC-1 probe staining in cells of ( d ). Data are expressed as mean ± SD. *** P < 0.001, **** P < 0.000 1. One-way ANOVA

Journal: Bone Research

Article Title: Chemotherapeutic drug-triggered AEP-cleaved G3BP1 orchestrates stress granules/nucleoli/mitochondria in osteosarcoma

doi: 10.1038/s41413-025-00453-w

Figure Lengend Snippet: tG3BP1-Cs bind to mitochondrial mRNA targets and suppress their translation to alleviate mitochondrial stress. a Representative images of the colocalization of tG3BP1-Cs with the mitochondrial marker TOMM20 in Hela cells. Scale bar = 10 μm. b RNP-IP analysis of the mRNA target encoding ribosomal proteins and oxidative phosphorylation binding to tG3BP1-Cs ( n = 3) in tG3BP1-Cs overexpressed U2OS cells. c Ribosome profiling-qPCR analysis demonstrated that tG3BP1 overexpression in U2OS cells significantly downregulates mitochondrial genes translation. d WB analysis of mitochondrial genes expression in cell lines exposed to cisplatin (50 μmol/L) or vehicle for 6 h. e Cisplatin-induced mitochondrial damage was detected by JC-1 probe staining in cells of ( d ). Data are expressed as mean ± SD. *** P < 0.001, **** P < 0.000 1. One-way ANOVA

Article Snippet: Stable cell lines of U2OS, 143B, and U87-MG were seeded in 96-well cell culture plates and treated with cisplatin (50 μmol/L) or appropriate vehicle solution for 6 h. OCR Fluorometric Assay Kit (Cat# E-BC-F068, Elabscience, Wuhan, China) was used according to manufacturer’s protocol.

Techniques: Marker, Phospho-proteomics, Binding Assay, Over Expression, Expressing, Staining